معلومة

تركيز الحمض النووي بواسطة الأيزوبروبانول

تركيز الحمض النووي بواسطة الأيزوبروبانول


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لقد قرأت أنه يمكن تركيز الحمض النووي بإضافة الأيزوبروبانول.

ماذا تعني كلمة "مركزة"؟ ماذا يفعل الأيزوبروبانول على المستوى الجزيئي لتركيز الحمض النووي؟


ما تسأل عنه هو ترسيب الحمض النووي (أو أي حمض نووي آخر) بواسطة الأيزوبروبانول (أو الإيثانول ، وهو الأكثر شيوعًا). للقيام بذلك ، أضف الملح (عادة أسيتات الصوديوم الحمضية قليلاً) مما يضمن أن العمود الفقري للفوسفات في الحمض النووي مشبع بأيونات الصوديوم لجعله أقل قابلية للذوبان. ثم تضيف المذيب العضوي ، الذي يترسب الحمض النووي من المحلول عن طريق تغيير قطبية المحلول. هذا يجعل الأيونات تشكل الأملاح ورواسب الحمض النووي. تم شرح المبدأ في مقالة ويكيبيديا حول ترسيب الإيثانول. أخيرًا ، يُطرد المحلول مركزيًا لجمع الحمض النووي في الجزء السفلي من أنبوب التفاعل الخاص بك ولتتمكن من خلع المادة الطافية.


تركيز الحمض النووي بواسطة الأيزوبروبانول - علم الأحياء

يستخدم هذا الإجراء لاستخراج DNA البلازميد من معلقات الخلايا البكتيرية ويستند إلى إجراء التحلل القلوي الذي طوره بيرنبويم ودولي (Nucleic Acids Research 7: 1513 ، 1979). يستفيد الإجراء من حقيقة أن البلازميدات عبارة عن جزيئات DNA صغيرة نسبيًا فائقة الالتفاف وأن الحمض النووي للكروموسومات البكتيري أكبر بكثير وأقل فائق الالتفاف. يسمح هذا الاختلاف في الطوبولوجيا بالترسيب الانتقائي للحمض النووي الصبغي والبروتينات الخلوية من البلازميدات وجزيئات الحمض النووي الريبي. يتم تحلل الخلايا تحت ظروف قلوية ، مما يفسد طبيعة كل من الأحماض النووية والبروتينات ، وعندما يتم تحييد المحلول بإضافة خلات البوتاسيوم ، يترسب الحمض النووي والبروتينات الصبغية لأنه من المستحيل عليها إعادة النضج بشكل صحيح (فهي كبيرة جدًا). تتجدد البلازميدات بشكل صحيح وتبقى في المحلول ، وتفصلها بشكل فعال عن الحمض النووي والبروتينات الكروموسومية. رائع ، أليس كذلك؟

ملاحظة: يتم استخدام الإجراء أدناه لعمل minipreps مكررة. يوفر هذا أنابيب متوازنة لجهاز الطرد المركزي بالإضافة إلى ضعف كمية المنتج عند الانتهاء.

1. قم بتدوير محتويات أنبوب الثقافة برفق لإعادة تعليق الخلايا.

2. قم بتسمية اثنين من الأنابيب سعة 1.5 مل وماصة 1000 ميكرو لتر من تعليق الخلية في كل أنبوب.

    يجمع هذا الجزء من الإجراء الخلايا البكتيرية المعلقة في الوسط السائل في حبيبات خلية في أسفل الأنبوب.
    يتم الآن تعليق الخلايا في محلول مخزّن باستخدام RNase. عندما يتم تحليل الخلايا في الخطوة التالية ، فإن الحمض النووي الريبي يحفز التحلل المائي لجميع جزيئات الحمض النووي الريبي إلى نيوكليوتيدات ، لكن الحمض النووي لن يتأثر.
    SDS هو اختصار لكبريتات الصوديوم دوديسيل. إنه منظف أيوني يعطل أغشية الخلايا ويزعزع استقرار جميع التفاعلات الكارهة للماء التي تحمل جزيئات كبيرة مختلفة في شكلها الأصلي. يؤدي ارتفاع درجة الحموضة لـ 0.2 M NaOH أيضًا إلى تغيير طبيعة الجزيئات الكبيرة عن طريق تغيير حالة المجموعات المؤينة (تأين مجموعات معينة وإزالة الأيونات الأخرى). المقاصة التي تراها هي أن الخلايا تتحلل. تزداد لزوجة المحلول بزيادة تركيز الجزيئات الكبيرة في المحلول (نتيجة تحلل الخلية).
    هذه حقًا هي الخطوة الأساسية في إجراء التحلل القلوي. يؤدي انخفاض الرقم الهيدروجيني لمحلول أسيتات البوتاسيوم إلى تحييد هيدروكسيد الصوديوم وعندما يعود الأس الهيدروجيني إلى شبه الحياد ، فإن الكريات الكبيرة تتجدد. ومع ذلك ، فإن البروتينات وجزيئات الحمض النووي الكبيرة لا تتطور بشكل صحيح. إنها تشكل روابط كارهة للماء وأيونية وهيدروجينية مع بعضها البعض بشكل غير محدد لأنه لم يتم الحفاظ على التشكل الصحيح للجزيء أثناء التمسخ. ومع ذلك ، فإن جزيئات DNA البلازميد لا يتم تغيير طبيعتها تمامًا لأنها جزيئات دائرية صغيرة ملفوفة بشكل كبير. على الرغم من أن الروابط الهيدروجينية بين أزواج القواعد قد تم كسرها بسبب ارتفاع درجة الحموضة ، إلا أنها يتم إصلاحها بشكل صحيح عند انخفاض الأس الهيدروجيني. تشكل جزيئات الحمض النووي الكبيرة (DNA الكروموسومات) والبروتينات ترسبات لأنها ترتبط ببعضها البعض في مجموعة كبيرة ولكن البلازميدات لا تترسب لأنها تتجدد بشكل صحيح ولا تصبح جزءًا من التكتلات الكبيرة متعددة الجزيئات. وهكذا يبقى DNA البلازميد في محلول بينما تترسب البروتينات وجزيئات الحمض النووي الأخرى.

10. ضع الأنابيب في جهاز طرد مركزي (متوازن) ودور بأقصى سرعة لمدة 5 دقائق. كوّن فريقًا مع بعض الأشخاص الآخرين في هذه الجولة. سوف يكون الراسب بيليه على طول جانب الأنبوب.

11. نقل المواد الطافية إلى أنابيب نظيفة 1.5 مل ، مع الحرص على عدم التقاط أي من الراسب. تجاهل الأنابيب مع الترسيب و احتفظ بالأنابيب مع المادة الطافية.

    سيؤدي هذا التركيز من الأيزوبروبانول إلى جعل الحمض النووي غير قابل للذوبان. نظرًا لأن جزيئات الحمض النووي أيونية (شحنة سالبة موحدة بسبب الفوسفات) فهي قابلة للذوبان في الماء بدرجة عالية ولكنها غير قابلة للذوبان في المذيبات العضوية. يشيع استخدام الأيزوبروبانول والإيثانول لترسيب الحمض النووي من محلول مائي.

14. أضف 200 ميكرولتر من الإيثانول المطلق إلى كل أنبوب واخلطه عن طريق الانقلاب عدة مرات.

    سيؤدي "غسل الإيثانول" هذا إلى تسريع العملية لأن الخطوة التالية هي تبخير الكحول المستخدم في خطوة الترسيب. يتبخر الإيثانول المطلق أسرع بكثير من محلول الأيزوبروبانول بنسبة 50٪.

17. ضع الأنابيب في غطاء الدخان مع فتح الأغطية لمدة 15-20 دقيقة لتجفيف آخر آثار الإيثانول.


عزل الحمض النووي الجيني

تعتبر الإنتاجية والنقاء والنزاهة ضرورية للأداء في التطبيقات النهائية مثل PCR والتسلسل. تحسين منهجيات الاستخراج هو مفتاح النجاح مع أنواع العينات الصعبة وتطبيقات المصب. يجب أن يكون الحمض النووي المستهدف المنقى خاليًا من الملوثات ، بما في ذلك البروتينات والمكونات الخلوية الأخرى والأحماض النووية غير المرغوب فيها.

قد تكون هناك حاجة إلى مجموعات تنقية خاصة من نوع العينة للعينات الأكثر تعقيدًا والتحدي التي تحتوي على الحمض النووي المتحلل أو التي تحتوي على تركيزات منخفضة من الحمض النووي. تشمل أنواع العينات الصعبة أنسجة FFPE أو البلازما أو المصل المحتوي على حمض نووي خالٍ من الخلايا أو عينات الطب الشرعي أو أي مصدر تكون فيه كمية العينة محدودة.

كانت Promega واحدة من أوائل الشركات التي قدمت مجموعات لتنقية الحمض النووي ، وكذلك البلازميدات ، مع أكثر من 30 عامًا من الخبرة في استخراج الحمض النووي. نحن نقدم مجموعة واسعة من مجموعات استخراج الحمض النووي الجينومي المناسبة لمجموعة متنوعة من أنواع العينات واحتياجات الإنتاجية ، مما ينتج عنه إنتاجية عالية وحمض نووي عالي الجودة لاستخدامه في تطبيقاتك النهائية. تغطي منتجاتنا مجموعة متنوعة من خيارات الإنتاجية وطرق المعالجة المناسبة لاحتياجاتك الخاصة و [مدش] من الإعدادات الفردية اليدوية إلى الأنظمة الآلية الصغيرة أو الكبيرة الحجم.

باستخدام الطرق القائمة على الدوران أو الفراغ أو المغناطيسية ، فإن حلول الإعداد الفردي اليدوية لدينا هي الأفضل لمعالجة أقل من 24 عينة في المرة الواحدة. إذا كنت تبحث عن حل تلقائي ، فإن أطقمنا التي تعتمد على الخرطوشة للاستخدام مع Maxwell & reg Instruments يمكنها معالجة ما يصل إلى 48 عينة في نفس التشغيل. نقدم أيضًا خيارات استخراج عالية الإنتاجية مؤتمتة بالكامل باستخدام طرق معالجة قائمة على الألواح ، متوافقة تمامًا مع منصات معالجة السوائل.

على الرغم من أن تقنيات مثل النشاف الجنوبي ، والتي تتطلب كميات ميكروغرام من الحمض النووي ، لا تزال تُجرى في مختبرات البيولوجيا الجزيئية ، إلا أن معظم تقييمات الحمض النووي الصبغي تتم بواسطة تقنيات تعتمد على تفاعل البوليميراز المتسلسل (PCR). وهي تشمل PCR أحادي أو متعدد الإرسال ، مصفوفات SNP ، التحليل و PCR في الوقت الحقيقي ، ddPCR وتسلسل الجيل التالي (NGS). تستخدم هذه التقنيات الأخيرة كميات نانوجرام من الحمض النووي لكل تفاعل. بغض النظر عن النظام المختار ، توفر مجموعات تنقية الحمض النووي الجينومي من Promega العوائد المطلوبة من الحمض النووي عالي الجودة مع الحد الأدنى من الملوثات.

أنظمة التنقية اليدوية

الأنظمة القائمة على الحلول

تقدم Promega أنظمة عزل الجينوم DNA على أساس تحلل العينة بواسطة المنظفات والتنقية بطرق مختلفة. وتشمل هذه الأنظمة القائمة على الغشاء (على سبيل المثال ، نظام تنقية الحمض النووي الجيني (Cat. # A2360 ، A2361) أو نظام تنقية الحمض النووي الجيني عالي الإنتاجية ، 96-well Wizard & reg SV 96 Genomic DNA Purification System (Cat. # A2370 ، A2371) وأنظمة السيليكا المغناطيسية المؤتمتة بسهولة. كل هذه الأنظمة تنقي الحمض النووي الجيني القابل للاستخدام في العديد من التطبيقات النهائية.

إن مجموعة Wizard & reg لتنقية الحمض النووي الجينومي (Cat. # A1120 ، A1125 ، A1620) عبارة عن نظام متعدد الاستخدامات وقابل للتطوير لعزل الحمض النووي الجيني باستخدام طريقة تعتمد على الترسيب. مع هذا النظام وحده ، يمكن عزل الحمض النووي الكروموسومي من الدم الكامل (5) ، أوراق النبات (6) ، البكتيريا موجبة الجرام (7) والبكتيريا سالبة الجرام (8) ، ذيل الفأر (9) والخميرة (10). تم أيضًا استخدام أنواع عينات إضافية مثل الفطريات (11) وأنسجة الضفادع المصابة المضمنة في البارافين (12) واللعاب (13) وخنافس الدقيق (14) بنجاح.

لا ينجح نظام تنقية الجينوم هذا مع العديد من أنواع العينات فحسب ، بل يمكن أيضًا تحجيمه بسهولة من أجل كمية مواد البدء عن طريق ضبط أحجام الكاشف لتلائم احتياجاتك.

الأنظمة المستندة إلى العمود

الأنظمة التقليدية القائمة على الأعمدة

للعزل أحادي العمود ، يوفر نظام Wizard® SV Genomic DNA Purification System تقنية سريعة وبسيطة لتحضير الحمض النووي المنقى والسليم من ذيول الفئران والأنسجة والخلايا المستنبتة في أقل من 20 دقيقة ، اعتمادًا على عدد العينات المعالجة (حتى 24 عن طريق الطرد المركزي ، اعتمادًا على حجم الدوار ، أو حتى 20 عن طريق الفراغ). يتم استخدام مشعب فراغ أو جهاز طرد مركزي صغير لمعالجة العينات. مع بعض التعديلات ، يمكن أيضًا استخدام الدم الكامل مع نظام العزل هذا (15). هذا نظام قائم على غشاء السيليكا ، مما يعني أن هناك قيودًا على كمية المواد التي يمكن تحميلها على عمود SV واحد يصل إلى 20 مجم من الأنسجة (ذيل فأر أو نسيج حيواني) أو بين 1 × 10 4 و 5 × 10 6 يمكن معالجة خلايا زراعة الأنسجة لكل عملية تنقية. مع المزيد من العينة ، قد تحتاج المحللة المعدة إلى تقسيمها بين عمودين أو أكثر لتجنب الانسداد.

الشكل 2. تضخيم الحمض النووي المعزول من مصادر الأنسجة المختلفة باستخدام Wizard & reg SV Genomic DNA DNA Purification System. تم تضخيم ميكروليتر واحد من الحمض النووي الجيني المنقى باستخدام PCR Master Mix (Cat. # M7502) وأشعال IL-1 و beta الخاصة بالماوس (منتج 1.2 كيلوبايت). تم إجراء التفاعلات مع DNA الجينوم الماوس (Cat. # G3091 + C) وبدون DNA (& ndashC) كعناصر تحكم إيجابية وسلبية ، على التوالي. كانت ظروف التدوير الحراري: دورة واحدة مدتها 3 دقائق عند 95 درجة مئوية تليها 30 دورة: 95 درجة مئوية لمدة 30 ثانية ، و 60 درجة مئوية لمدة دقيقة واحدة ، و 70 درجة مئوية لمدة دقيقة واحدة و 30 ثانية تمديد نهائي عند 70 درجة مئوية لمدة 7 دقائق 4 درجة مئوية ونقعها. احتوت جميع الممرات على 10 ميكرول من منتج التفاعل مفصولة على هلام الاغاروز 1٪. تم تصور منتجات PCR بواسطة تلطيخ بروميد الإيثيديوم. تشير التعيينات & ldquoSpin & rdquo و & ldquoVacuum & rdquo إلى البروتوكول المستخدم لعزل الحمض النووي الجيني.

الحمض النووي الجيني المعزول باستخدام نظام Wizard® SV الجينومي لتنقية الحمض النووي ذو جودة عالية ويعمل بشكل جيد في تحليل هلام الاغاروز وهضم إنزيمات التقييد وتحليل PCR كما هو موضح في الشكل 2. يقدم الجدول 1 عوائد نموذجية للحمض النووي الجيني المنقى من مجموعة متنوعة مصادر.

الجدول 1. إنتاجية الحمض النووي الجينومي النموذجي من أنسجة مختلفة باستخدام نظام Wizard® SV Genomic DNA Purification System.

عينة كمية متوسط ​​العائد
قص الذيل 20 ملغ 20 ميكروغرام
كبد 20 ملغ 15 ميكروغرام
قلب 20 ملغ 10 ميكروغرام
مخ 20 ملغ 6 ميكروغرام
خلايا CHO 1 × 10 6 5 ميكروغرام
خلايا NIH / 3T3 1 × 10 6 9 ميكروغرام
293 خلية 1 × 10 6 8 ميكروغرام

استخدم الباحثون هذا النظام البسيط والسريع للعديد من أنواع العينات الإضافية والتطبيقات بما في ذلك البعوض (16) ، والخلايا الجذعية للثدي (17) ، العصوية الرقيقة (18), الإشريكية القولونية (19) ، شكل اليرقات من البلهارسيا المنسونية طفيلي (20) والحمض النووي الفيروسي من خلايا BC3 المصابة بفيروس Kaposi & rsquos sarcoma (21).

للحصول على عزل عالي الإنتاجية ، 96 بئرًا ، يتوفر نظام Wizard & reg SV 96 Genomic DNA Purification System. يمكن عزل الحمض النووي الجيني القابل للتضخيم من 5 مرات أو 10 6 خلايا ، أو 20 مجم من الأنسجة أو ما يصل إلى 1.2 سم من طرف ذيل الفأر دون الطرد المركزي للمحلول قبل التنقية.

يتطلب نظام مولتيويل هذا مشعب فراغ (Vac-Man & reg 96 Vacuum Manifold، Cat. # A2291) ومضخة تفريغ قادرة على توليد 15 & ndash20 بوصة من الزئبق أو ما يعادلها. تم عزل الحمض النووي الجينومي من ثلاثة أنواع مختلفة من المصادر ، ثم استخدم في PCR أحادي الاتجاه وتشغيله على هلام agarose كما هو موضح في الشكل 3. الشكل 4 يقارن العائد من ثلاثة أساليب Wizard & reg SV الجينومية لتنقية الحمض النووي (لوحة 96 بئر ، فراغ وطرد مركزي ).

الشكل 3. الرحلان الكهربائي للهلام Agarose لمنتجات PCR تضخيم من 1 & microl من ذيل الفأر وخلايا CHO وعينة أوراق الطماطم DNA المعزولة باستخدام Wizard & reg SV 96 Genomic DNA Purification System. يتم عرض إجمالي 10 ميكرول من منتج PCR على هلام agarose 1.5٪ ملطخ ببروميد الإيثيديوم. اللوحة أ. تضخيم IL-1 و beta (1.2 كيلو بايت) من ذيل الفأر. اللوحة B. & بيتا أكتين (250 نقطة أساس) تضخيمًا من خلايا CHO. لوحة C. تم تضخيم الحمض النووي للبلاستيدات الخضراء (600 نقطة أساس) من أوراق الطماطم. Lane M ، 1 كيلوبايت DNA Ladder (Cat. # G5711).

الشكل 4. مقارنة غلات الحمض النووي باستخدام Wizard & reg SV و SV 96 Genomic DNA Purification Systems. متوسط ​​إنتاج الحمض النووي الجيني بالميكروغرام المنقى من قصاصات ذيل الفأر 20 ملغ. متوسط ​​أ260280 النسب هي: SV 96 ، 1.7 & plusmn 0.08 SV طريقة فراغ ، 1.7 & plusmn 0.14 SV طريقة الدوران ، 1.7 & plusmn 0.14.

أنظمة قائمة على الأعمدة عالية الأداء

نحن نقدم نوعين مختلفين من أنظمة ReliaPrep & trade gDNA Miniprep التي تنقي الحمض النووي الجيني باستخدام طريقة قائمة على عمود السليلوز: نظام ReliaPrep & trade Blood gDNA Miniprep (Cat. # A5081، A5082) ونظام ReliaPrep & trade gDNA Tissue Miniprep (Cat. # A2051، A2052). كلاهما نظامان جاهزان للاستخدام يحصلان على الحمض النووي الجيني السليم دون استخدام غسولات الإيثانول أو الترسبات. يقوم نظام ReliaPrep & trade Blood gDNA Miniprep بمعالجة 200 & مول من الدم أو سوائل الجسم ، سواء كانت طازجة أو مجمدة ، في أقل من 40 دقيقة. المحصول من الدم عادة 4 & ndash10 & mug ، وهذا يتوقف على عدد خلايا الدم البيضاء. يمكن معالجة ما يصل إلى 25 مجم من الأنسجة ، أو مسحة من الخد (الخد) أو ذيل الفأر 1 سم باستخدام نظام Miniprep للأنسجة ReliaPrep & trade gDNA والحمض النووي الذي تم استعادته في 30 دقيقة أو أقل. يمكن استخلاص الحمض النووي المنقى في أقل من 50 ومايكرول ومناسب للاستخدام في تطبيقات المصب مثل RT-qPCR.

الشكل 5. إنتاجية الحمض النووي الجيني من نظام ReliaPrep & trade Blood gDNA Miniprep يختلف باختلاف عدد خلايا الدم البيضاء. تم الحصول على دم كامل من عدة أفراد ، وتم تحديد تعداد خلايا الدم البيضاء باستخدام جهاز قياس الكريات. تم استخدام مائتي ميكرولتر من الدم لتنقية الحمض النووي الجيني (ن = 3 أو 4) ، وتم تحديد كمية gDNA المعزول بواسطة التحليل الطيفي للامتصاص.

الشكل 6. مقارنة حجم الشطف مع التركيز والمحصول والنقاء. تمت معالجة قسامات الدم (200 & mul) باستخدام نظام ReliaPrep & trade Blood gDNA Miniprep (ن = 4) وتم التصفية منه باستخدام 30 & ndash200 & mul من المياه الخالية من نوكلياز. تركيز (لوحة أ) ، العائد الإجمالي (لوحة ب) والنقاء (لوحة ج) باستخدام التحليل الطيفي الامتصاصية. انخفض المحصول بشكل طفيف مع انخفاض في حجم الشطف ، بينما زاد التركيز. ظلت النقاء المقاسة بنسب الكثافة الضوئية ثابتة.

الأنظمة الآلية لتنقية الحمض النووي

بينما تحاول المختبرات تحسين الإنتاجية للبحث والتشخيص والاختبار التطبيقي ، ازدادت الحاجة إلى أتمتة عمليات التنقية سهلة الاستخدام ومنخفضة إلى متوسطة الإنتاجية. تقضي الأتمتة على الوقت العملي والعمل في التنقية اليدوية ، مما يمنحك المزيد من الوقت والطاقة للتركيز على بحثك.

الأنظمة المعتمدة على الخرطوشة

تقليديا ، تشير الأتمتة إلى استخدام معدات كبيرة ومتخصصة ومكلفة تتطلب تدريبًا مكثفًا للتشغيل والصيانة. طورت Promega أنظمة Maxwell® ، التي توفر بدائل مرنة وموثوقة ومضغوطة وسهلة الاستخدام للأنظمة الآلية التقليدية.

تم تصميم أنظمة Maxwell® للتنقية المؤتمتة والفعالة من مجموعة واسعة من أنواع العينات (انظر الجدول 2). يتم تزويد أجهزة Maxwell® بطرق تنقية آلية مبرمجة مسبقًا ، ويمكنها معالجة ما يصل إلى 48 عينة في أقل من 30-40 دقيقة (حسب الأداة ونوع العينة والطريقة). الحمض النووي أو الحمض النووي الريبي المركز المنقى بجودة عالية وعائد مرتفع ، مما يجعلها متوافقة مع العديد من التطبيقات النهائية الشائعة ، بما في ذلك qPCR و ddPCR والتنميط الجيني والتسلسل و NGS.

الشكل 7. Maxwell® RSC (يسار) و Maxwell® RSC 48 (يمين).

الجدول 2. العائد الحمض النووي من أنواع العينات المختلفة بعد التنقية باستخدام Maxwell & reg RSC Instrument and DNA Purification Kits.

ما يصل إلى 50 ملغ من أنسجة الكبد
ما يصل إلى 50 ملغ من أنسجة الرئة

تقدم Maxwell & reg Kits خراطيش كاشف معدة مسبقًا لتنقية الحمض النووي الجيني والحمض النووي الريبي والحمض النووي الكلي. مجموعات التطبيقات والعينات التي تركز على نوع العينة تجعل من Maxwell & reg Instruments أداة استخراج متعددة الاستخدامات للمختبرات التي قد تعمل مع واحد أو كل هذه التطبيقات المختلفة.

الشكل 8. تبدأ طرق استخراج Maxwell® RSC DNA أو RNA بخراطيش مملوءة مسبقًا بكواشف تنقية وجزيئات مغناطيسية جاهزة لعيناتك. بعد إضافة العينة ، يحرك Maxwell® RSC الجسيمات البارامغناطيسية والأحماض النووية المرتبطة بها من خلال خطوات متعددة ينتج عنها في النهاية RNA أو DNA عالي النقاء في 30-100 ميكرولتر.

تعمل أنظمة Maxwell & reg على تنقية العينات باستخدام الجسيمات شبه المغناطيسية (PMPs) ، والتي توفر مرحلة صلبة متحركة تعمل على تحسين التقاط العينات وغسلها وشطف الحمض النووي. تعد Maxwell & reg Instruments أدوات معالجة الجسيمات المغناطيسية التي تربط الأحماض النووية بكفاءة بالجسيمات البارامغناطيسية في البئر الأول لخرطوشة مملوءة مسبقًا. تتم معالجة العينات من خلال سلسلة من الغسل قبل التصفية من الحمض النووي. تتجنب المنهجية القائمة على الجسيمات المغناطيسية المنتظمة المستخدمة من قبل Maxwell & reg Instruments المشكلات الشائعة المرتبطة بأنظمة التنقية القائمة على معالجات السوائل الآلية ، مثل الأطراف المسدودة أو عمليات النقل الجزئية للكواشف ، والتي يمكن أن تؤدي إلى معالجة تنقية دون المستوى الأمثل.

إن أدوات Maxwell & reg المدمجة التي توضع فوق الطاولة سهلة الإعداد ولا تتطلب تدريبًا خاصًا للاستخدام. يتم تحميل الطرق المؤتمتة المُحسَّنة مسبقًا ، ويتم قطع خراطيش الكاشف المعبأة مسبقًا في مكانها ، وتضاف عينتك وتختار "ابدأ" لبدء الطريقة المناسبة. تتوفر قائمة كاملة بمجموعات استخلاص الأحماض النووية هنا.

تتوفر العديد من مجموعات كاشفات أجهزة Maxwell & reg وتسمح بالاستخراج الأمثل من مجموعة متنوعة من أنواع العينات ، بما في ذلك الدم والمصل والبلازما والأنسجة الثابتة بالفورمالين والمدمجة بالبارافين (FFPE) والبكتيريا والنباتات والأغذية والأنسجة الحيوانية.

تسمح أنظمة Maxwell & reg HT بتنقية الحمض النووي أو الحمض النووي الريبي على نطاق واسع على أي معالج سائل في المختبر بتنسيق SLAS 24 أو 96 جيدًا. تستخدم كيمياء تنقية ماكسويل وريج حلولًا جديدة تعتمد على الجسيمات المغناطيسية تقلل بشكل طبيعي من انتقال التلوث.

بالإضافة إلى الكيمياء الموثوقة ، تحصل على دعم الخبراء لبدء التشغيل الآلي أو تحسين سير عمل HT الحالي. يمكن لفريق خبراء الأتمتة لدينا تقديم المساعدة مع معظم مزودي أتمتة المعامل الرائدين في العالم ومساعدتك على تطوير وتنفيذ حل آلي لتنقية الحمض النووي مخصص لاحتياجات مختبرك.

أطقم استخراج الحمض النووي الجينومي

هل تبحث عن خيارات الاستخراج حسب مقياس العينة أو النوع؟ استكشف مجموعة استخراج الحمض النووي الخاصة بنا لاكتشاف الحل المناسب لاحتياجات التنقية لديك.

حلول أتمتة قابلة للتطوير

توفر أجهزة Maxwell® RSC منصة مدمجة ومؤتمتة لتنقية الحمض النووي تعالج ما يصل إلى 16 عينة (Maxwell ® RSC) أو ما يصل إلى 48 عينة (Maxwell ® RSC 48) في وقت واحد.

كيمياء التنقية عالية الإنتاجية ودعم الأتمتة

تسمح كيمياء Maxwell® HT بأتمتة تنقية الحمض النووي على معالجات السوائل. يقدم فريق خبراء الأتمتة لدينا المساعدة للمساعدة في تطوير وتنفيذ حل آلي لتنقية الحمض النووي مخصص لاحتياجات مختبرك.

أنظمة عالية الإنتاجية لعزل الحمض النووي الجيني

تقدم Promega العديد من الخيارات الآلية عالية الإنتاجية لعزل عزل الحمض النووي الجيني من عينات الدم. بعض المختبرات ، مثل البنوك الحيوية ، لديها رغبة في عزل الحمض النووي من كميات كبيرة من المواد الأولية (على سبيل المثال ، 10 مل من الدم). يوفر نظام عزل ReliaPrep & trade HT gDNA ذو الحجم الكبير (Cat. # A2751) وسيلة فعالة لعزل الحمض النووي الجيني المشتق من أجزاء الدم المشتقة من عينات 2.5 و ndash10ml من الدم الكامل. يمكن أتمتة هذه الكيمياء على معالجات السوائل باستخدام جهاز Promega HSM ، والذي يتيح معالجة تفاعلات التنقية في أنابيب مخروطية سعة 50 مل.

يعمل برنامج استشعار مستوى السائل وتشغيل الأجهزة على قياس الكيمياء لأخذ عينات من حجم المدخلات لكل عينة فردية ، مما يقلل من نفايات الكاشف والمصاريف. يمكن للنظام الآلي أيضًا معالجة العينة في أنابيب 14 مل باستخدام محول الحجم المنخفض XAT1020 (LVA والطرق) الذي يتيح معالجة العينات من 0.25 و ndash3ml.

لا توجد خطوات طرد مركزي مملة أو مواد كيميائية خطرة ، والتي تتعامل بطبيعتها مع محطة العمل ، وتقدم تنقية سريعة للحمض النووي الجيني من الدم الكامل ، بغض النظر عن ظروف تخزين العينات أو الشحن.

الشكل 9. تم عزل الحمض النووي من الدم الكامل عبر ثلاث طرق ، تم فصلها عن طريق الفصل الكهربائي للهلام CHEF وتم تصورها بواسطة تلطيخ بروميد الإيثيديوم. الحمض النووي المعزول باستخدام نظام عزل HT gDNA كبير الحجم من ReliaPrep & trade زود الحمض النووي بنطاق حجم من 20 إلى 125 كيلو بايت تنقية تعتمد على الترسيب معزولة للحمض النووي بنطاق حجم من 20 إلى 200 كيلو بايت بينما أظهرت الطرق القائمة على العمود جدنا بحجم 20-75 كيلو بايت.

يوجد خيار لعزل إنتاجية منخفضة لـ gDNA من ما يصل إلى 32 عينة في وقت واحد عند استخدام Heater Shaker Magnet Instrument (HSM 2.0 Cat. # A2715) على مقعد مقابل مدمج في معالج سائل حيث يقوم المستخدم بالتوزيع والنضح الكواشف من العينات حسب توجيهات البرنامج على شاشة الكمبيوتر. تتحكم الطرق المبرمجة مسبقًا في التسخين والرج والمغنطة وتوقيت الخطوات المطلوبة للتنقية شبه الآلية.

بالإضافة إلى الدم الكامل ، يمكن أيضًا معالجة مجموعة متنوعة من أنواع العينات الأخرى ، بما في ذلك اللعاب المستقر ، وعينات غسيل الخد ، وكسور الدم ، والمعاطف المغطاة بالدم ، وكريات الخلايا الحمراء وجميع كريات الخلايا. للتنقية المؤتمتة بالكامل ، يمكن دمج جهاز HSM 2.0 مع محطة عمل آلية لمعالجة السوائل.

تتطلب أتمتة الكواشف على الأجهزة نهجًا مخططًا ومنفذًا بعناية. يمنحك التعاون مع Promega إمكانية الوصول إلى العلماء الذين صمموا تنقية آلية لمئات من المعامل ، عبر مجموعة واسعة من أنواع العينات.

تتطلب أتمتة الكواشف على الأجهزة نهجًا مخططًا ومنفذًا بعناية. يمنحك التعاون مع Promega إمكانية الوصول إلى العلماء الذين صمموا تنقية آلية لمئات من المعامل ، عبر مجموعة واسعة من أنواع العينات.

الشكل 10. غلات الحمض النووي الآلي لكسور الدم. يكون إنتاج الحمض النووي خطيًا فيما يتعلق بأحجام الدم الأصلية. لوحة أ. غلة الحمض النووي كما هو محدد بواسطة مقياس الطيف الضوئي NanoDrop. لوحة ب. غلة الحمض النووي كما هو محدد باستخدام نظام QuantiFluor & trade dsDNA. تم تحضير جميع العينات من متبرع واحد. تمت معالجة العينات اليدوية باستخدام Wizard & reg Genomic DNA Purification Kit. كل نقطة هي متوسط ​​n = 4 قيم مع أشرطة خطأ لانحراف معياري واحد.

تنقية الحمض النووي HT المخصص

قد يكون تنفيذ تقنيات تنقية الحمض النووي المؤتمتة على سير العمل عالي الإنتاجية تحديًا ويستغرق وقتًا طويلاً. يمكن لعلماء الدعم الميداني لدينا تقديم الدعم الذي تحتاجه للبدء.

مجموعات تنقية الحمض النووي المحددة حسب نوع العينة

تعرف على المزيد حول بعض مجموعاتنا المتخصصة أدناه ، واستكشف اتساع نطاق محفظتنا وقارن مجموعات استخراج الحمض النووي لدينا بمساعدة صفحة مقارنة منتجاتنا لاكتشاف الحل المناسب لاحتياجات تنقية الحمض النووي الخاصة بك.

عزل الحمض النووي الجيني للأنسجة الثابتة

يوفر MagneSil® Genomic، Fixed-Tissue System (Cat. # MD1490) تقنية سريعة وبسيطة لتحضير الحمض النووي الجيني من الأنسجة المثبتة بالفورمالين والمضمنة بالبارافين. بعد هضم بروتين K بين عشية وضحاها ، يمكن تنقية الحمض النووي الجيني يدويًا من أقسام الأنسجة الرقيقة FFPE في أقل من ساعة. يمكن عزل الحمض النووي الجيني المضخم من أقسام 10 ميكرومتر دون الطرد المركزي للمحلول قبل التنقية. يمكن معالجة ما يصل إلى 12 عينة بالتنسيق اليدوي باستخدام حامل الفصل المغناطيسي MagneSphere® Technology (Cat. # Z5332، Z5342).

الشكل 11. تحليل الحمض النووي المنقى من المقاطع الرقيقة 10 ميكرومتر المضمنة بالبارافين والمثبتة بالفورمالين باستخدام نظام الأنسجة الثابتة الجينومي MagneSil®. تم تضخيم الحمض النووي المنقى ، وتم تحليل منتجات التضخيم باستخدام محلل وراثي ABI PRISM® 310 أو 3100. لوحة أ. التضخيم مع مجموعة من 16 الاشعال المسمى الفلورسنت. تتراوح منتجات التضخيم في الحجم من 104 إلى 420 قاعدة. لوحة ب. تم تضخيم جزء من 972 قاعدة باستخدام مجموعة التمهيدي الأميلوجينين. لوحة ج. جزء بحجم 1.8 كيلو بايت تم تضخيمه من ملف داء السلائل القولونية الغدية (APC) الجين. قد تساعد زيادة وقت التمديد أثناء التضخيم في موازنة العوائد بين منتجات التضخيم الصغيرة والكبيرة وزيادة عوائد منتجات التضخيم الكبيرة. ستختلف النتائج اعتمادًا على درجة الارتباط المتبادل بسبب تثبيت الفورمالين.

تتمثل إحدى الميزات التي يتمتع بها هذا النظام على طرق التنقية الأخرى ، مثل استخراج الفينول: الكلوروفورم ، في قدرته على إزالة معظم مثبطات التضخيم ، بما في ذلك الأجزاء الصغيرة جدًا من الحمض النووي. قد تكون الأنسجة التي تم تخزينها في الفورمالين لفترات طويلة من الزمن متشابكة للغاية أو متدهورة للغاية بحيث لا تؤدي بشكل جيد كقالب للتضخيم. يوضح الشكل 11 تضخيمًا لـ 16 موقع تكرار ترادفي قصير (STR) ويوضح مدى جودة عمل الحمض النووي المعزول في PCR متعدد الإرسال باستخدام PowerPlex® 16 HS System (Cat. # DC2101، DC2100).

تعتبر مجموعة Maxwell® RSC FFPE Plus DNA Kit (Cat. # AS1720) طريقة آلية لتنقية ما يصل إلى 48 عينة من قسم واحد إلى عشرة أقسام بحجم 5 ميكرومتر من عينات الأنسجة FFPE على أداة Maxwell® RSC (Cat. # AS4500 1–16 خرطوشة لكل تشغيل) أو أداة Maxwell® RSC 48 (Cat. # AS8500 1-48 عينة لكل تشغيل). تم تصميم كيمياء FFPE Plus لتوفير إنتاجية عالية من الحمض النووي من FFPE عند قياسها بواسطة التحليل الطيفي المناسب لتطبيقات التضخيم بما في ذلك qPCR و multlex PCR و NGS. يوفر البروتوكول المرونة من خلال إزالة سريعة للكفاءات لمدة ساعة أو بروتوكول طوال الليل ليلائم احتياجات تدفق العمل لديك.

كيمياء Maxwell® RSC DNA FFPE هي أحدث تقنيات FFPE من Promega وقد تم تصميمها لتوفير DNA عالي التضخيم. وفر الوقت والعمالة من خلال استخدام كيمياء FFPE مع أدوات Maxwell® ، وتجنب التعرض للزيلين الخطير المستخدم في منتجات تنقية FFPE الأخرى. أظهر اختبار الجودة أيضًا عدم وجود مثبطات تفاعل البوليميراز المتسلسل تقريبًا في عينات الحمض النووي المنقى ، مما يجعل تفاعل البوليميراز المتسلسل (PCR) والتطبيقات النهائية الأخرى في غاية السهولة.

باستخدام نفس الكيمياء مثل Maxwell® RSC FFPE DNA ، يوفر نظام عزل Maxwell® HT DNA FFPE (Cat. # A6372) طريقة بسيطة وموثوقة لعزل سريع وعالي الإنتاجية للحمض النووي الجيني من عينات الأنسجة FFPE. لا يتطلب النظام مذيبًا عضويًا ، مما يجعله آمنًا ومناسبًا للاستخدام ، ويمكن استخدام الحمض النووي المنقى مباشرة في مجموعة متنوعة من التطبيقات النهائية ، بما في ذلك PCR و NGS.

يعمل نظام عزل Maxwell® HT DNA FFPE على تنقية الحمض النووي باستخدام جزيئات مغناطيسية ، والتي توفر مرحلة صلبة متحركة لتحسين ربط وغسل وتنقية gDNA. إن استخدام الجسيمات البارامغناطيسية لعزل الحمض النووي يلغي الحاجة إلى الطرد المركزي أو المشعبات الفراغية ، مما يجعل النظام مناسبًا للأتمتة الكاملة.

نظرًا لأن عينات FFPE يمكن أن يكون لها جودة متفاوتة على نطاق واسع بسبب طبيعة تثبيت العينة وعملية التضمين ، يمكن أن تكون مراقبة الجودة للعينات جزءًا مهمًا من سير عمل FFPE.

الشكل 12. البيانات المقارنة للكيمياء Maxwell & reg RSC DNA FFPE مقابل كيمياء Maxwell & reg RSC FFPE Plus DNA. وقد لوحظ أن طريقة Maxwell & reg RSC FFPE Plus DNA تنتج المزيد من الغلة عن طريق الامتصاص والفلورة ، بينما تنتج طريقة Maxwell & reg RSC DNA FFPE المزيد من العائد بواسطة PCR.

قياس الطيف الضوئي طريقة شائعة لتقييم جودة استخراج الحمض النووي والحمض النووي الريبي. تحتوي معظم المختبرات على مقياس الطيف الضوئي NanoDrop Microvolume (أو جهاز مشابه) وهي سهلة الاستخدام بشكل لا يصدق. ماصة 1-2 ميكرولتر من العينة ، حدد "تحليل" وتوفر الأداة قراءة من التركيز والنقاء عبر A260280 و أ260230 النسب في بضع ثوانٍ فقط. أحدثت هذه الأجهزة ثورة في تحديد كمية العينات الروتينية في المختبر ، ولكن هل هي أفضل طريقة لتقييم عينات FFPE؟ هناك نوعان من الاعتبارات الرئيسية عند استخدام NanoDrop: الحساسية والنزاهة. يمكن أن تحتوي عينات FFPE على عائد واسع النطاق من الحمض النووي أو الحمض النووي الريبي في كثير من الأحيان أقل من 10 نانوغرام أو أقل في حجم يتراوح من 10 ميكرولتر إلى 100 ميكرولتر من الاستخراج. يمكن أن يؤدي هذا إلى تركيزات عينة أقل من النطاق الخطي لـ NanoDrop. بالإضافة إلى ذلك ، كمقياس طيف ضوئي ، فإنه لا يفرق بين RNA أو DNA أو النيوكليوتيدات الحرة ، مما قد يؤدي إلى عدم دقة كبيرة في قياسات تركيز DNA / RNA. أخيرًا ، لا توجد طريقة لتحديد ما إذا كانت العينة يمكن الوصول إليها للمقايسات الأنزيمية النهائية لأنها لا تستطيع الكشف عن وجود أو عدم وجود روابط متقاطعة (أو أضرار أخرى) داخل العينة.

الكميات الصبغية مثل نظام Promega QuantiFluor® dsDNA (Cat. # E2670، E2671) ، يوفر طريقة سريعة وأكثر حساسية بشكل ملحوظ لتقدير dsDNA أو RNA مقارنةً بالتحليل الطيفي للامتصاص. توفر هذه الطريقة تقديرًا مفيدًا للتركيز. عند النظر في عينات FFPE ، من المهم ملاحظة أن القياس الكمي القائم على الصبغة لا يقدر سلامة الحمض النووي / الحمض النووي الريبي أو مدى الارتباط المتبادل في العينة ، مما قد يؤثر على النجاح في فحوصات المصب.

فحوصات التحجيم (على سبيل المثال ، هلام الاغاروز ، محطة الشريط ، محلل الشظايا ، DV200) يمكن أن توفر تقديرًا للتركيز - والأهم من ذلك - معلومات عن توزيع حجم الأجزاء في العينة. يمكن أن يتم تجزئة الحمض النووي المشتق من FFPE ، بسبب عملية التثبيت ، بشكل كبير مقارنة بالحمض النووي من الأنسجة المجمدة حديثًا. يوجد أدناه تتبع محلل شظية (الشكل 13) وعشرات DV200 المرتبطة (الجدول 3) للحمض النووي المعزول من أقسام FFPE باستخدام خمس طرق تنقية مختلفة. في حين أن آثار التحجيم تقوم بتقييم توزيع حجم الحمض النووي المنقى ، فإنها لا تقيس درجة الارتباط المتبادل داخل العينة أو وجود مثبطات.

الشكل 13. تتبع محلل شظية الحمض النووي المعزول من أقسام FFPE باستخدام خمس طرق تنقية مختلفة.

الجدول 3. عشرات DV200 من الحمض النووي المعزولة من أقسام FFPE باستخدام خمس طرق تنقية مختلفة في تتبع محلل شظية (الشكل 13).

طريقة 1 (أخضر فاتح) 2 (أزرق) 3 (أحمر) 4 (برتقالي) 5 (أخضر)
DV200 71.8 69.9 70.1 58.7 80.5

على سبيل المثال ، عندما تم قياس نفس العينات بواسطة فحوصات qPCR لأهداف مختلفة وأحجام شظايا ، فإن العائد بواسطة qPCR لا يرتبط جيدًا بنتائج DV200. في الواقع ، في هذا المثال ، كان للعينات ذات الدرجات الأدنى من DV200 أكبر عائد بواسطة qPCR (الشكل 14).

الشكل 14. غلة qPCR من الحمض النووي المعزولة من أقسام FFPE. The same samples of DNA isolated by five different purification methods in the fragment analyzer trace and DV200 table above were quantitated by qPCR assays of various targets and fragment sizes.

While there are general trends, the DV200 score does not necessarily correlate with success in downstream assays such as qPCR.

qPCR has several advantages for the quantitation of FFPE samples. First, qPCR can be very sensitive, requiring only a small amount of sample and detecting pg/µl amounts of DNA. In terms of sensitivity in nucleic acid detection, it is surpassed only by ddPCR. qPCR can also provide a measure of how degraded or crosslinked a DNA sample may be since nucleic acid must be a suitable substrate for a DNA polymerase for a signal to be generated. Absorbance may not represent the sample suitable for the downstream assay because it will detect DNA, fragmented DNA and nucleotides. Finally, most qPCR QC assays, such as the ProNex® DNA QC Assay (Cat.# NG1004, NG1005) provide internal controls which are used to detect the presence of inhibitors in the sample prior to attempting a more expensive assay. This can help you assess not only the integrity of the nucleic acids, but also the likelihood of an amplification-based assay to be successful.

NGS is another assay used by some labs to QC their samples. هناك عدة أسباب لذلك. Some labs are trying to get as much data as possible from very precious samples, in which case any sequence information may be worth the expense and risk of failed sequencing runs. As a QC test, NGS may provide a lot of information, but it is expensive and can require large amounts of sample and time. Some labs run low pass NGS, which uses highly-multiplexed samples to lower the cost per sample to determine if it is worth the time and resources to sequence deeper. Most sequencing and purification providers recommend qPCR assays to quantitate FFPE DNA, as all NGS workflows depend primarily on the success of enzymatic amplification steps to obtain sequencing-ready DNA as part of library preparation steps.

Table 4. Comparative Pros and Cons of Various QC Assays.

طريقة سرعة حساسية Quantitative? Measure Purity? Assess size of NA? Detect Cross- linking? كلفة
Spectrophotometry (NanoDrop) +++ + Semi - quantitative + - - $
Dye-Based Quantitation +++ ++ ص - - - $
DV200 ++ + Semi - quantitative - +* - $$
هلام الكهربائي ++ +/- Semi - quantitative - +* - $
qPCR ++ +++ ص +* + + $
NGS + ص + ++ + $$$

Plant Genomic DNA Isolation

The Wizard® Magnetic 96 DNA Plant System (Cat.# FF3760, FF3761) is designed for manual or automated 96-well purification of DNA from plant leaf and seed tissue. The Wizard® Magnetic 96 DNA Plant System has been validated with corn and tomato leaf as well as with canola and sunflower seeds. The DNA purified from these samples can be used in PCR and other more demanding applications, such as RAPD analysis. Since plant materials can be particularly challenging to lyse, especially when working with tough or woody tissues, additional required equipment includes not only a magnet (MagnaBot® FLEX 96 Magnetic Separation Device, Cat.# VA1920) but also a device capable of breaking up seed or leaf material (e.g., Geno/Grinder® 2000 from SPEX CertiPrep, Inc.).

The yield depends on the source material and how well the seeds or leaf disks are pulverized prior to the genomic DNA isolation. Yield may range from 10–100ng from a single 8mm leaf punch. To increase the yield from the Wizard® Magnetic 96 DNA Plant System, a scale up in volume with up to 5 leaf punches can be used [as demonstrated in Promega Notes 79]. The potential scale-up is limited by the volume in a deep-well, 96-well plate.

Another automated option we have to meet your plant DNA extraction needs, is the Maxwell® RSC Plant DNA Kit (Cat.# AS1490). The Maxwell® RSC Plant DNA Kit is used with the Maxwell® RSC and RSC 48 Instruments to provide an easy method for efficient, automated purification of genomic DNA (gDNA) from a range of plant tissue samples, including corn, soybean and أرابيدوبسيس. The Instruments are supplied with preprogrammed purification methods and uses predispensed reagent cartridges, maximizing simplicity and convenience.

Using this system, DNA can be purified from plant samples in under 60 minutes with minimal preprocessing and no organic extractions. Automated purification results in consistent purification, with less variability than traditional DNA extraction methods such as CTAB and spin-columns. The resulting purified DNA is ready to use in downstream applications, including amplification assays.

Serum-Plasma Genomic DNA Isolation

For high quality, purified cell-free DNA from plasma samples, we offer the Maxwell® RSC ccfDNA Plasma Kit (Cat.# AS1480). Utilizing the simple three-step protocol, the Maxwell® RSC Instrument can process 1 to 16 samples, and the Maxwell® RSC 48 Instrument can process 1 to 48 samples. Simply add 0.2–1.0ml of plasma to the prepared cartridges and select Start, no preprocessing of samples required. In approximately 70 minutes, you will have high yields of amplifiable DNA that is ready to be used in downstream assays including qPCR, NGS and digital PCR.

As a magnetic particle mover, not a liquid handler, the Maxwell® RSC additionally offers several advantages over other automated systems. Since no liquid handling or splashing occurs during sample processing, there is minimal risk of sample cross-contamination. It also eliminates the worry of potential clogs and inevitable system breakdowns that follow, ensuring a smooth workflow with fewer disruptions.

Bacterial Genomic DNA Isolation

If you need to make quick decisions about potential food contamination and spoilage, the Maxwell® RSC PureFood Pathogen Kit (Cat.# AS1660) offers a simple automated protocol with minimal hands-on steps. The kit effectively eliminates laborious sample preprocessing steps such as enzymatic pretreatment, as it works with inhibiting sample types and also has the ability to lyse both Gram+ or Gram– bacteria.

By coupling the high-performance Maxwell® chemistries with the trusted benchtop Maxwell® RSC instruments, you will be able to effectively purify bacterial DNA from up to 48 food samples in as little as 40 minutes. Once extracted, the resulting DNA is ready for advanced downstream molecular analyses, including serotyping, NGS and identification of spoilage organisms.

This method can be utilized for both raw and processed food and has successfully been used to isolate pathogen DNA from a wide variety of food samples, including بكتريا قولونية 0157:H7 from uncooked beef, السالمونيلا المعوية from uncooked chicken and الليسترية المستوحدة from whole milk. Figure 15 below highlights a comparison of total DNA versus بكتريا قولونية 0157:H7 DNA extracted from cilantro samples that were spiked with the بكتريا قولونية 0157:H7 bacteria.

Figure 15. Comparison of total DNA and بكتريا قولونية 0157:H7 DNA extracted from cilantro samples spiked with the indicated amounts of بكتريا قولونية 0157:H7 bacteria. The total DNA concentration was assessed using the QuantiFluor® ONE dsDNA System.

Buffy Coat Genomic DNA Isolation

The Maxwell® RSC Buffy Coat DNA Kit (Cat.# AS1540) provides a simple, automated method of genomic DNA extraction using the convenient, prefilled cartridge format of the Maxwell® RSC Instrument. The kit contains all the reagents you need for optimal DNA extraction, and is compatible with blood stored in EDTA, heparin and citrate anticoagulants. Avoid the tedious and time-consuming hassle of preprocessing samples, simply add 50–250μl of your sample directly into well #1 of the cartridges. Your purified DNA is ready for analysis in about 50 minutes, and can be used directly in various downstream applications, such as agarose gel electrophoresis.

Food Genomic DNA Isolation

Food and plant materials often provide the greatest challenge for cell lysis and intact DNA extraction, due to the lysis conditions required to liberate the nucleic acid and the processing of plant materials into comestibles.

Another specialized genomic DNA isolation system is the Wizard® Magnetic DNA Purification System for Food (Cat.# FF3750, FF3751). This convenient protocol is designed for the manual purification of DNA from a variety of food samples including corn seeds, cornmeal, soybeans, soy flour and soy milk, generating results in one-third of the time of traditional methods. In addition, DNA can be purified from processed food such as corn chips, chocolate and chocolate-containing foods, lecithin and vegetable oils if used with the appropriate optimized protocols.

The DNA purified from many of these samples can be used in PCR-based testing for Genetically Modified Organism (GMO) DNA sequences, such as by quantitative analysis using TaqMan® assays. As with all isolation systems using the MagneSil® PMPs, a magnetic separation stand is needed and enables processing of up to 12 samples per batch. With samples containing highly processed food, the genomic DNA isolated will be fragmented and better suited for analysis using amplification rather than a Southern blot. The yield of DNA from this system will vary depending on source type and extent of food processing.

The Maxwell® RSC PureFood GMO and Authentication Kit (Cat.# AS1600) provides an easy and automated method for efficient purification of DNA for PCR-based food and ingredient authentication. The Kit is used with the Maxwell® RSC and RSC 48 Instruments and can purify DNA from raw and processed food samples, including corn, soybeans, canola, ground beef and ground pork.

100 minute protocol requires only 30 minutes of hands-on time, effectively achieving not only faster results with walk-away automation, but also freeing up laboratory resources for higher value activities. The purified DNA extracted using the PureFood Kit is ready to be used for several applications, including real-time PCR, gel electrophoresis, next-generation and Sanger sequencing and microarrays.

Nucleic Acid Purification Protocols for Plant & Food Sample Types

Explore our collection of protocols for manual and automated DNA or RNA extraction from a variety of food and plant samples.


  • A series of lab exercises giving instructions for the extraction of DNA from several different starting materials. The exercise is designed for the 6-12 grade level.

The following resources were originally accessed through the BioSciEd Net (BEN) digital resources collection, which is the National Science Digital Library (NSDL) Pathway for biological sciences education. For more teaching resources, please visit BEN to use their searchable database. BEN is free to use, but requires registration.

    - This lab, from AccessExcellence enables students to work with DNA concretely by easily isolating chromosomal DNA using the same basic tools and methods that scientists use. - this Science NetLinks website provides lesson plans that develop understanding of DNA by modeling the process of DNA extraction.
  • [link https://web.archive.org/web/20190222033127/http://www.apsnet.org/edcenter/K-12/TeachersGuide/DNA_Easy/Pages/default.aspx 'DNA the Easy Way (and Gram Stain Without the Mess)'] - This resource, by the American Phytopathological Society, is a short laboratory exercise that teaches students the procedures of DNA isolation from bacterial cells. In addition, students learn how to determine the Gram-stain reaction of bacterial isolates. : This Access Excellence resource provides a laboratory activity where students use DNA fingerprinting analysis to determine the perpetrator of a fictitious crime. - This resource requires you to log in to BEN to view (which requires a subscription to BEN, which is free). This PDF document offers a detailed manual of protocols and instructional information for carrying out an undergraduate laboratory exercise in molecular biology and cenetics, in which students use polymerase chain reaction to create DNA fingerprints from their own hair. It includes student outlines, instructor's notes, and suggested questions for laboratory reports.

عن

إعادة استخدام

يتم تقديم المواد الواردة في هذه الصفحة بموجب ترخيص المشاع الإبداعي ما لم يُذكر خلاف ذلك أدناه.


DNA purification by isopropanol precipitation

مقدمة

Isopropanol precipitation is a simple method for DNA purification. Here, a protocol which I adopted in my former experiments is introduced. Alternatively, DNA-containing solution can be mixed with the same volume of isopropanol, then treated just like the protocol for ethanol precipitation. We have also tried DNA purification by &lsquoCTAB precipitation&rsquo method, but this trial was far from successful [1].

Reagent

High-Salt Solution for Precipitation (Takara, Kusatsu, Japan).

بروتوكول

Be careful so as not to directly touch isopropanol with your skin.

Add half volume (of DNA solution) of High-Salt Solution for Precipitation and mix.

Add the same volume (as High-Salt Solution for Precipitation) of isopropanol and mix. Place at room temperature for 10 min. Centrifuge at the maximum speed for 10 min at 4°C. Discard supernatant.

Add 1 mL of 70% ethanol. Place at &minus80°C for 15 min.

Thaw out sample and immediately proceed to centrifugation at the maximum speed for 5 min at 4°C. Discard all supernatant and dry.


Purification and concentration of DNA from aqueous solutions

This unit presents basic procedures for manipulating solutions of single- or double-stranded DNA through purification and concentration steps. The Basic Protocol, using phenol extraction and ethanol precipitation, is appropriate for the purification of DNA from small volumes (<0.4 ml) at concentrations <1 mg/ml. Isopropanol may also be used to precipitate DNA, as described in an alternate protocol. Three support protocols outline methods to buffer the phenol used in extractions, concentrate DNA using butanol, and extract residual organic solvents with ether. An alternative to these methods is nucleic acid purification using glass beads, and is described here. These protocol may also be used for purifying RNA. The final protocols provide modifications to the Basic Protocol that are used for concentrating RNA and extracting and precipitating DNA from larger volumes and from dilute solutions, and for removing ow-molecular-weight oligonucleotides and triphosphates.


Make a chart (with diagrammatic representation) showing a restriction enzyme, the substrate DNA on which it acts, the site at which it cuts DNA and the product it produces.

â–² Fig. 7.3. EcoRI cuts the DNA between bases G and A only when the sequence GAATTC is present in the DNA.


DNA Extraction Protocol for Plants with High Levels of Secondary Metabolites and Polysaccharides without Using Liquid Nitrogen and Phenol

Mangroves and salt marsh species are known to synthesize a wide spectrum of polysaccharides and polyphenols including flavonoids and other secondary metabolites which interfere with the extraction of pure genomic DNA. Although a plethora of plant DNA isolation protocols exist, extracting DNA from mangroves and salt marsh species is a challenging task. This study describes a rapid and reliable cetyl trimethylammonium bromide (CTAB) protocol suited specifically for extracting DNA from plants which are rich in polysaccharides and secondary metabolites, and the protocol also excludes the use of expensive liquid nitrogen and toxic phenols. Purity of extracted DNA was excellent as evident by A260/A280 ratio ranging from 1.78 to 1.84 and A260/A230 ratio was >2, which also suggested that the preparations were sufficiently free of proteins and polyphenolics/polysaccharide compounds. DNA concentration ranged from 8.8 to 9.9 ميكرومترز ميكرومترL −1 . The extracted DNA was amenable to RAPD, restriction digestion, and PCR amplification of plant barcode genes (matK and rbcl). The optimized method is suitable for both dry and fresh leaves. The success of this method in obtaining high-quality genomic DNA demonstrated the broad applicability of this method.

1 المقدمة

The isolation of pure, intact, and high-quality DNA is very crucial for any molecular studies [1]. However, DNA isolation from plants is usually compromised by excessive contamination by secondary metabolites. The DNA isolation methods need to be adjusted to each plant species and even to each plant tissue because of the presence of these metabolites, unlike animals and microbes [2]. The search for a more efficient means of extracting DNA of both higher quality and yield has led to the development of several protocols for isolating DNA from plants containing high levels of secondary metabolites [3–7]. The mangroves and salt marsh are specially adapted to harsh environment such as marshy anoxic anaerobic soil and fluctuating salinity of the water bodies [8]. To avoid these stress conditions mangroves and salt marsh plants synthesize high amounts of polysaccharides, polyphenols, and other secondary metabolites such as alkaloids and flavanoids which impede DNA extraction [9, 10].

Many factors can cause shearing of DNA during extraction. Degradation of DNA due to endonucleases is one such problem encountered in the isolation and purification of high molecular weight DNA from plant, which directly or indirectly interfere with the enzymatic reactions [11]. Polysaccharides may be particularly problematic when present in DNA samples, as their presence may also inhibit enzymatic activity. Presence of polysaccharides has been shown to inhibit طق polymerase activity [12] and restriction enzyme activity [13]. The presence of polysaccharides in the DNA sample is characterized by formation of a highly viscous solution [14]. The oxidized form of polyphenols covalently binds to DNA giving a brown colour and reduces maintenance time, making it useless for molecular studies [15].

Apart from traditional extraction approaches, several commercial kits are also accessible to extract genomic DNA from plants with sufficient quality [16]. For extracting genomic DNA an initial mechanical grinding of the leaf sample is carried out in the presence of liquid nitrogen, where the ultimate aim is to access the nuclear material without degradation. Numerous DNA isolation protocols use phenol to separate cellular molecules and debris from the DNA which is toxic, hazardous, expensive, and require special containment facilities to maximize personnel safety and minimize environmental concerns. However, the convenience provided by the above-mentioned methods may be cost prohibitive when considering experiments with limited financial resources.

Several researchers have attempted to eliminate the use of hazardous chemicals, expensive kits, equipment, and labour-intensive steps for high throughput DNA extraction. However, these methods do have demerits such as limited shelf life, low purity, low recovery, and poor amplification [17, 18]. Mostly the DNA extraction protocols recommend fresh leaf samples for genomic DNA isolation, but it seems impractical when the samples are collected from remote and rare locations. These situations necessitate the development of the protocols for isolating DNA from dried leaf samples. The objective of this study was to develop a simple method to isolate DNA in an open laboratory environment, a method that eliminates the need to use liquid nitrogen and toxic phenol. The resulting optimized CTAB (Cetyl trimethylammonium bromide) protocol enables the isolation of high quality genomic DNA amenable to RAPD (Random amplified Polymorphic DNA), restriction digestion, and amplification of plant barcode genes (matK and rbcl) with reduced cost and health concerns.

2. Materials and Method

2.1. Plant Samples for DNA Isolation

Young, tender, and unbruised leaves of mangroves (Rhizophora mucronata, Rhizophora apiculata, Aegiceras corniculatum, Lumnitzera racemosa, Lumnitzera littorea, Bruguiera gymnorrhiza, Bruguiera cylindrica, Scyphiphora hydrophyllacea, Avicennia marina, Avicennia officinalis, و Xylocarpus mekongensis) and salt marsh (Suaeda maritima و Sesuvium portulacastrum) were collected from Pichavaram Mangrove Forest, Tamil Nadu, India and stored in −80°C until use. The leaves were preferred for DNA extraction due to their continued availability whole year round. A minimum of ten accessions were taken for each genus. Dried leaves of Rhizophora و Avicennia ص. were also taken to scrutinize the applicability of the optimized extraction protocol.

2.2. Extraction Methods

Plant genomic DNA extraction Kit (GeNei), CTAB DNA extraction method by Porebski et al. [4], J. J. Doyle and J. L. Doyle [19], and Saghai-Maroof et al. [20] were employed for extracting DNA from the study plants. Among all the tested protocols, Saghai-Mahroof method yielded convincing results. Therefore, this method was taken and optimized for DNA extraction by varying the concentration of Tris-HCl, NaCl (Sodium Chloride),

-mercaptoethanol, and PVP (PolyVinyl Pyrrolidone).

2.3 Standardized Extraction Method

(i) Preheat suspension buffer (pH 8) containing 50 mM EDTA, 120 mM Tris-HCl, 1 M NaCl, 0.5 M sucrose, 2% Triton-X 100, and 0.2% -mercaptoethanol (to be freshly added just before use) in water bath at 60°C. (ii) Grind −80°C stored leaves (1 g) to fine powder in ice cold condition in the presence of 250 mg PVP (PolyVinyl Pyrrolidone, Mr 10,000) by using pre chilled mortar and pestle (−40°C/−80°C).

ملحوظة: To avoid usage of liquid nitrogen, this method is successfully employed. If −80°C is not available, −40°C/−20°C can also be used. Lower the temperature and lower will be the chances of DNA degradation (nuclease activity). Appearance of brown colour indicates DNA degradation. (iii) Transfer the content in 2 mL microcentrifuge tubes and suspend in two volumes of suspension buffer. (iv) Invert and mix gently and incubate at 60°C for 40 min. (v) Centrifuge the suspension at 10,000 rpm for 15 min at room temperature. (vi) Add 1.5 mL of extraction buffer containing 20 mM EDTA, 100 mM Tris-HCl, 1.5 M NaCl, 2% CTAB, 1% -mercaptoethanol and incubate at 60°C for 30 min. (vii) Centrifuge at 12,000 rpm for 15 min at room temperature. (viii) Carefully transfer the aqueous phase into a new tube.

ملحوظة: Use wide-bore tips for transferring the aqueous phase to avoid mechanical damage to DNA. (ix) Add double volume of Chloroform: Isoamyl alcohol (24 : 1), and invert gently 15 to 20 times and centrifuge at 12,500 rpm for 15 min.

ملحوظة: If the aqueous layer appears translucent, repeat the step until the solution is transparent. (x) Add double volume of chilled isopropanol and keep at −20°C for one hour to precipitate the DNA.

ملحوظة: The longer the chilled incubation, the more the precipitation. (xi) Centrifuge at 12,000 rpm for 15 min and discard the supernatant. (xii) To the pellet, add 70% chilled ethanol and spool out the pellet carefully and centrifuge again at 12,000 rpm for 15 min. (xiii) Discard the supernatant and vacuum dry or air dry the pellet at room temperature.

ملحوظة: Make sure that there is no residual ethanol, this is very critical especially if the DNA is to be used directly for PCR. Overdrying should also be avoided as it makes the pellet difficult to resuspend. (xiv) Add 100

L of high salt TE buffer (0.5 M NaCl, 10 mM Tris-HCl, 1 mM EDTA (pH 8). (xv) Add 3 L RNase (10 mg/mL) and keep at 37°C for 30 min followed by chloroform: isoamyl alcohol extraction and ethanol precipitation in the presence of 3 M sodium acetate (pH 5.2). (xvi) Spool out the DNA, wash in 70% ethanol, air or vacuum dry. (xvii) Add 30 to 50 L (depending upon the pellet) of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8) to dissolve the precipitate.

ملحوظة: Chelator present in TE can affect PCR and restriction digests. DNA in TE should be suitably diluted before use in such reactions. (xviii) Store at −20°C/−40°C till further use.

2.4 Qualitative and Quantitative Analysis of Extracted DNA

The DNA yield was measured by using a UV-Visible spectrophotometer (Perkin Elmer) at 260 nm. DNA purity was determined by calculating the absorbance ratio A260/280. Polysaccharide contamination was assessed by calculating the absorbance ratio A260/230 [21]. For quality and yield assessments, electrophoresis was done of all DNA samples in 0.8% agarose gel, stained with Ethidium Bromide and bands were observed in gel documentation system (Alpha Innotech).

2.5 Random Amplified Polymorphic DNA (RAPD) Study

The PCR amplification reaction was carried out with five random decamer primers (Rpl1 إلى Rpl5) obtained from GeNei (Bangalore) in a 25 L reaction volume containing 10 mM Tris-HCl, pH 8.3, 2.5 mM MgCl2, 1 mM dNTP mix, 0.2 M of each primer, 1 U of طق DNA polymerase, and 15 to 40 ng of template DNA. RAPD-PCR was performed in a thermalcycler (Tech Gene) for 40 cycles consisting of denaturation at 94°C for 30 sec, annealing at 45°C for 30 sec, and extension at 72°C for 60 sec. The final extension was carried out at the same temperature for 5 min. The amplified product was checked in 1.5% agarose gel electrophoresis and bands were observed in gel documentation system (Alpha Innotech).

2.6. Restriction Fragment Length Polymorphism (RFLP) Study

The extracted DNA was subjected to RFLP study [22]. Briefly, the reaction mixture was prepared by adding 10 L of extracted DNA, 15 L of 2X assay buffer, 10 L of BSA, and 3 L of restriction enzyme (بام hI, ECORI and PstI). The vials were incubated at 37°C for 1 hr for complete digestion. The restriction enzyme digested products were visualized through silver staining of the polyacrylamide gel. The gels were fixed in 50 mL of fixing solution (diluted five times with 30.4 mL double-distilled water and 9.6 mL ethanol) for 30 min and silver-impregnated (with 1X staining solution) for another 30 min. This was followed by washing the gels in double-distilled water for 1 to 2 min. After removing the staining solution the gels were then kept in the developing solution in dark for 10 min. When the bands were dark enough, the developing solution was poured out and the stopping and preserving solution was immediately added.

2.7. matK and rbcl Gene Amplification

PCR amplification of matK (trnK-F: gggttgctaactcaatggtagag trnK-R: tgggttgcccggggccgaac) and rbcl (rbcl-F: actgtagtaggtaaacttgaaggtgaacg rbcl-R: gaaccttcctcaaaaaggtctaaggggta) were carried out in 25 L reaction containing 1.0 U طق DNA polymerase, 1 mM dNTPs-Mix, 1Xطق buffer, 2.5 mM MgCl2, 20 mM of each amplification primer, and 10–50 ng of template DNA in a one-step touchdown PCR-program (1 cycle at 90 sec at 96°C, 60 sec at 50°C, 120 sec at 68°C, 35 cycles at 30 sec at 95°C, 60 sec at 48°C, 120 sec at 68°C, subsequent final elongation of 20 min at 68°C) [23]. Annealing temperature (

) ranged from 47 to 50°C with respect to different plant species. The amplified products were separated by electrophoresis in 1.5% agarose gel buffered with 1X TAE. Gels were stained with ethidium bromide, and bands were observed in gel documentation system (Alpha Innotech).

3. النتائج والمناقشة

Plant genomic DNA extraction Kit (GeNei) did not show promising results for mangroves and salt marsh species as evident by the presence of sticky polysaccharides in the pellet and sheared band in the agarose gel. We encountered many difficulties from the very first step of cell lysis to DNA separation in the supernatant and subsequent reactions when the CTAB DNA extraction method of Porebski et al. [4] and J. J. Doyle and J. L. Doyle [19] was followed. Highly viscous and sticky pellets were difficult to handle and the brownish pellet, indicated contamination by phenolic compounds [24]. The amount of DNA obtained with these protocols was very low, and the quality was also poor for most of the samples. A260/A280 ratio was less than 1.6, that is, below the optimal limit of 1.8 [25] making the DNA nonamenable for molecular studies. But, interestingly the CTAB method described by Saghai-Maroof et al. [20] gave better DNA yield in terms of quality and quantity from the study plants. Hence, this method was considered for the purpose of standardization at varying concentration of Tris-HCL, -mercaptoethanol, NaCl, and PVP (Figure 1).


Genomic DNA isolated from plant leaves resolved under 0.8% agarose gel. Lane1 shows the DNA isolated by using Plant genomic DNA extraction Kit (GeNei) Lane2, Lane3, and Lane4 shows the isolated DNA by the CTAB method described by J. J. Doyle and J. L. Doyle [19] Porebski et al. [4] and Saghai-Maroof et al. [20] respectively. Lane5 to Lane8 represents the isolated DNA by the present optimized extraction method (Lane1 to Lane4 represents A. marina Lane5 represents the isolated DNA from salt marsh (Suaeda maritima) Lane6 and Lane7 illustrate the isolated genomic DNA from the fresh leaves of A. marina, whereas Lane8 represents the DNA isolated from dried leaves of A. marina).

The success of the optimized extraction method in obtaining high-quality genomic DNA from all the tested mangrove and salt marsh species demonstrated the broad applicability. DNA concentration of the extraction method ranged from 8.8 to 9.9 g L −1 . The use of prechilled mortar and pestle and −40°C/−80°C stored leaf sample successfully substituted the use of costly liquid nitrogen. The final DNA pellets were white with no visible discoloration. It has been reported that high level of -mercaptoethanol successfully removes the polyphenols [26]. Therefore, high concentration of β-mercaptoethanol was used which made the protocol good for extraction of high-quality DNA. The addition of NaCl at concentrations higher than 0.5 M, along with CTAB, is known to remove polysaccharides during DNA extraction [24, 27]. The concentration of NaCl varied with plant species in a range between 0.7 M [28] to 6 M [29]. In the present study, higher level of NaCl (1.5 M) in the extraction buffer further improved the quality of the extracted DNA. The high quality of obtained DNA could also be attributed to the use of a higher concentration of PVP (2.5%) with lower molecular weight (10,000) rather than 40,000. A number of workers [30, 31] have recommended the use of PVP with molecular weight of 10,000 at 2% (w/v) to address the problem of phenolics. PVP with low molecular weight has less tendency of precipitating with the nucleic acids as compared to PVP with high molecular weight thus yielding sufficient amount of polyphenol-free DNA [32].

Purity of extracted DNA was excellent as evident by A260/A280 ratio ranging from 1.78 to 1.84 and A260/A230 ratio was >2, suggesting that the preparations were sufficiently free of proteins and polyphenolics/polysaccharide compounds [20]. Clear banding patterns were observed in the RAPD study (Figure 2). The extracted DNA was also amenable for RFLP study and amplification of plant barcode genes as evident in Figures 3 and 4, respectively. The successfully amplified barcode genes sequences were sequenced and submitted to Genbank (Accession numbers: JQ433951, JQ421082, JQ511854, and JQ421083)


Concentration of DNA by isopropanol - Biology

Materials: see Solutions for Recipes

  1. Measure the volume of the DNA sample. Adjust the salt concentration by adding 1/10 volume of sodium acetate, pH 5.2, (final concentration of 0.3 M) or an equal volume of 5 M ammonium acetate (final concentration of 2.0-2.5 M). These amounts assume that the DNA is in TE only if DNA is in a solution containing salt, adjust salt accordingly to achieve the correct final concentration. اخلط جيدا. Add 2 to 2.5 volumes of cold 100% ethanol (calculated after salt addition). اخلط جيدا.
  2. Place on ice or at -20 degrees C for & GT20 minutes.
  3. Spin a maximum speed in a microfuge 10-15 min.Carefully decant supernatant. Add 1 ml 70% ethanol. مزج. Spin briefly. Carefully decant supernatant. Air dry or briefly vacuum dry pellet.
  4. Resuspend pellet in the appropriate volume of TE or water.

تتم صيانة صفحة الويب هذه بواسطة Julie B. Wolf، UMBC
آخر تحديث في 3/2/2010

تم تصميمه للطلاب المهتمين بالمهن في العلوم الصناعية والطبية الحيوية.


شاهد الفيديو: عراقية أجرت تحليل الحمض النووي لمعرفة تاريخ عائلتها والنتيجة مفاجأة - DNA test? - HIND DEER (كانون الثاني 2023).